View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1864_low_8 (Length: 370)
Name: NF1864_low_8
Description: NF1864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1864_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 17 - 367
Target Start/End: Original strand, 36269756 - 36270106
Alignment:
| Q |
17 |
cttataagatccaattgtgtatcacattgcttcaatgtcttcttcctcgcaggaacagaaccagaaggtgaatctgtcaacgattcagaactctctgcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36269756 |
cttataagatccaattgtgtatcacattgcttcaatgtcttcttcctcgcaggaacagaaccagaaggtgaatctgtcaacgattcagaactctctgcaa |
36269855 |
T |
 |
| Q |
117 |
gcttcactttcttcttcttagtttttctcagctccattttgaactctttttctaccctaactgtttcttccacattgtcaacaccaacaacagtttcttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36269856 |
gcttcactttcttcttcttagtttttctcagctccattttgaactccttttctaccctaactgtttcttccacattgtcaacaccaacaacagtttcttg |
36269955 |
T |
 |
| Q |
217 |
ttcttgttcttcttccttgttcttacgctttctctgaagcttcaaagactctggtaccttttctctatattgacgatgcttcccttgaagataatgaatc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36269956 |
ttcttgttcttcttccttgttcttacgctttctctgaagcttcaaagactctggtaccttttctctatattgacgatgcttcccttgaagataatgaatc |
36270055 |
T |
 |
| Q |
317 |
tcacacagtttcagattatccatcactctcctcttgcaccgcctttgcttc |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36270056 |
tcacacagtttcagattatccatcactctcctcttgcaccgccattgcttc |
36270106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University