View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18651_high_23 (Length: 320)

Name: NF18651_high_23
Description: NF18651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18651_high_23
NF18651_high_23
[»] chr6 (2 HSPs)
chr6 (189-306)||(27854698-27854815)
chr6 (19-119)||(27854885-27854985)


Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 189 - 306
Target Start/End: Complemental strand, 27854815 - 27854698
Alignment:
189 gcacttctagtgttactttttaattatctaatggcaatgaccaaatttcttctcatatcttttccgaacgaaatgttgcacggataagttagcaaatcat 288  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
27854815 gcacttctagtgttactttttaataatctaatggcaatgaccaaatttcttctcatatcttttgcgaacgaaatgttgcacggataagttagcaaatcat 27854716  T
289 ggtcatggcttggttgat 306  Q
    ||||||||||||||||||    
27854715 ggtcatggcttggttgat 27854698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 19 - 119
Target Start/End: Complemental strand, 27854985 - 27854885
Alignment:
19 ttacaatgtttcagcagtaaattttggtttctgaagttactgacaacacatgtgtcaccgtatggaggaactaacaatgaaagatgatatatttatagag 118  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
27854985 ttacaatgtttcagcagtaaattttggtttctgcagttactgacaacacatgcgtcaccgtatggaggaactaacaatgaaagatgatatatttatagag 27854886  T
119 a 119  Q
    |    
27854885 a 27854885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University