View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18651_high_27 (Length: 309)
Name: NF18651_high_27
Description: NF18651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18651_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 177 - 291
Target Start/End: Complemental strand, 9142804 - 9142690
Alignment:
| Q |
177 |
ataataatgcaattgtcttaacatataattagtaattgagtaaaagcataattgggttcatgtgatatgtttcttgcattgtcatggtttatgaatgtct |
276 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9142804 |
ataataaagcaattgtcttaacatatagttagtaattgagtaaaagcataattgggttcatgtgatatgtttcttgcattgtcatggtttatgaatgtct |
9142705 |
T |
 |
| Q |
277 |
catctatgcaaattg |
291 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9142704 |
catctatgcaaattg |
9142690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 88 - 182
Target Start/End: Complemental strand, 9142925 - 9142831
Alignment:
| Q |
88 |
catcaagatttcatgacttaatcaagtattgcggttatggaaaacaggaatatacattgcattagtaattgtcaatttagagttctcaaataata |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9142925 |
catcaagatttcatgacttaatcaagtattgcggttatggaaaacaggaatatacattgcattagtaattgtcaatttagagttctcaaataata |
9142831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University