View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18651_high_37 (Length: 269)
Name: NF18651_high_37
Description: NF18651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18651_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 254
Target Start/End: Complemental strand, 33220370 - 33220130
Alignment:
| Q |
14 |
ttctataaacctatcgtcaagagtacggtcactaagattaatttgggtctagtccttcatgtttagagttagatccactccacagaatgccaattacccc |
113 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33220370 |
ttctataaacctatcgtcaagagtacagtgactaagattaatttgggtctagtccttcatgtttagagttagatccactccacagaatgccaattacccc |
33220271 |
T |
 |
| Q |
114 |
cctttacttgtgggttagcggataccctgagtagtttcactttcgatggggactcttgccctgtcctaaacttcattactgttttggtcttttggaatag |
213 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33220270 |
cctttacttttgggttagcggataccctgagtagttttactttcgatggggactcttgccctgtcctaaacttcattactgttttggtcttttggaatag |
33220171 |
T |
 |
| Q |
214 |
tgtacccattctcacctgacacacctcctacttatacatat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33220170 |
tgtacccattctcacctgacacacctcctacttatacatat |
33220130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University