View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18651_high_39 (Length: 255)
Name: NF18651_high_39
Description: NF18651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18651_high_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 15330199 - 15329960
Alignment:
| Q |
1 |
catgaactttttaatgtaaattttcccttgctcaaaactcttcatttggaggccattgatttcaaagacagtaatggtcgcagtctttggattctccttt |
100 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15330199 |
catgaactttttcatgtcaattttcccttgctcaaaactcttcatttggaggcaattgatatcaaagacagtaatggtcgcagtctttggattctccttt |
15330100 |
T |
|
| Q |
101 |
atggctgtcccattttagaggaattgcaaacaaatggtttcttatttcggcgtaagttgaaagctggtagagacttcaatggcttacacaaattggtcag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15330099 |
atggctgtcccattttagaggaattgcaaacaaatggtttcttatttcggcgtaagttgaaggctggtagagacttcaatggcttacacaaattggtcag |
15330000 |
T |
|
| Q |
201 |
agcaaatattatgaacttgggttgcagtgttccgtttgat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15329999 |
agcaaatattatgaacttgggttgcagtgttccgtttgat |
15329960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University