View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18651_high_48 (Length: 231)
Name: NF18651_high_48
Description: NF18651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18651_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 134 - 220
Target Start/End: Complemental strand, 38059565 - 38059477
Alignment:
| Q |
134 |
gcatattgcattattctattatgaccttatctgctccaaggatttctctgtgtcccttgaacacat--aagaaggtatactctgttcat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38059565 |
gcatattgcattattctattatgaccttatctgctacaaggatttctttatgtcccttgaacacatgagagaaggtatactctgttcat |
38059477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 220
Target Start/End: Original strand, 38060889 - 38060977
Alignment:
| Q |
134 |
gcatattgcattattctattatgaccttatctgctccaaggatttct--ctgtgtcccttgaacacataagaaggtatactctgttcat |
220 |
Q |
| |
|
||||||| ||||| |||||||||| |||| |||| |||||| |||| |||||||||||| ||| || ||||||||||| ||||||| |
|
|
| T |
38060889 |
gcatattacattactctattatgaacttagatgcttcaaggaattctatctgtgtcccttggacaaatgtgaaggtatactttgttcat |
38060977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University