View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18651_high_51 (Length: 202)
Name: NF18651_high_51
Description: NF18651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18651_high_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 21 - 183
Target Start/End: Original strand, 7540004 - 7540166
Alignment:
| Q |
21 |
gataagggtacacttcttttagctacagttggtattgggataagccaaactttattcacattactatcatgttttttgttggataaaattgggagaagga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7540004 |
gataagggtacacttcttttagctacagttggtattgggataagccaaactttattcacattactatcatgttttttgttggataaaattgggagaagga |
7540103 |
T |
|
| Q |
121 |
ttctattattggtcagttcaggaggtgtgattttttctatgttagggttatgtgtttgttcag |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7540104 |
ttctattattggtcagttcaggaggtgtgattttttctatgttagggttatgtgtttgttcag |
7540166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University