View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18651_low_25 (Length: 320)
Name: NF18651_low_25
Description: NF18651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18651_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 189 - 306
Target Start/End: Complemental strand, 27854815 - 27854698
Alignment:
| Q |
189 |
gcacttctagtgttactttttaattatctaatggcaatgaccaaatttcttctcatatcttttccgaacgaaatgttgcacggataagttagcaaatcat |
288 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27854815 |
gcacttctagtgttactttttaataatctaatggcaatgaccaaatttcttctcatatcttttgcgaacgaaatgttgcacggataagttagcaaatcat |
27854716 |
T |
|
| Q |
289 |
ggtcatggcttggttgat |
306 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
27854715 |
ggtcatggcttggttgat |
27854698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 19 - 119
Target Start/End: Complemental strand, 27854985 - 27854885
Alignment:
| Q |
19 |
ttacaatgtttcagcagtaaattttggtttctgaagttactgacaacacatgtgtcaccgtatggaggaactaacaatgaaagatgatatatttatagag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27854985 |
ttacaatgtttcagcagtaaattttggtttctgcagttactgacaacacatgcgtcaccgtatggaggaactaacaatgaaagatgatatatttatagag |
27854886 |
T |
|
| Q |
119 |
a |
119 |
Q |
| |
|
| |
|
|
| T |
27854885 |
a |
27854885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University