View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18651_low_28 (Length: 317)
Name: NF18651_low_28
Description: NF18651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18651_low_28 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 37183379 - 37183694
Alignment:
| Q |
1 |
cgaattgttttctcaaaacttgatccgcgggagaggtctcttctgcagatcccttatgaactcacagatggcctatccg-agtataccattgagtttgcc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37183379 |
cgaattgttttctcaaaacttgatccgcgggagagggctcttctgcagatcccttatga--tcacagatggcctatccggagtataccattgagtttgcc |
37183476 |
T |
 |
| Q |
100 |
gcgcttgttgcggtcgtaaattccaagtttcctgaggtcggtaatctcttactcagaagaattgttttgcaattcaaaagggcttatcataggaatgaca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37183477 |
gcgcttgttgcggtcgtaaattccaagtttcctgaagtcggtaatcttttactcagaagaattgttttgcaattcaaatgggcttatcataggaatgaca |
37183576 |
T |
 |
| Q |
200 |
agcctcatcagttacatgctactgttaagtttatagcacgtttggtgaaacagctagttgcacatgagattattgctttggtaatactcacggttttgct |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37183577 |
agcctcatcagttacatgctactgttaagtttatagcacatttggtgaaacagctagttgcacatgagattattgctttggaaatactcacggttttgct |
37183676 |
T |
 |
| Q |
300 |
tgataaccctattgatga |
317 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37183677 |
tgataaccctattgatga |
37183694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University