View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18651_low_43 (Length: 254)
Name: NF18651_low_43
Description: NF18651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18651_low_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 69 - 225
Target Start/End: Original strand, 12855899 - 12856055
Alignment:
| Q |
69 |
gatacgtaatgccgccaaagcgaggggtttccttcgctaagaacggaagcaaaggaattcgttttcctattttgagtttcgttcttctatgtgttcttac |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12855899 |
gatacgtaatgccgccaaagcgaggggtttccttcgctaagagcggaagcaaaggaattcgttttcctattttgagtttcgttcttctatgtgttcttac |
12855998 |
T |
 |
| Q |
169 |
gccggttattttcttcttcggtcgaggttttcacgttactggttagttcattacttt |
225 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12855999 |
gccggttgttttcttcttcggtcgaggttttcacgttactggttagttcattacttt |
12856055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University