View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18651_low_51 (Length: 235)
Name: NF18651_low_51
Description: NF18651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18651_low_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 135 - 220
Target Start/End: Complemental strand, 10120109 - 10120024
Alignment:
| Q |
135 |
tgatgattaattagaagttagaagcagaatcttggttgcagttgtaacattagcatgtgagtatgtgtcatgtataacgttggttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
10120109 |
tgatgattaattagaagttagaagcagaatcttggttgcagttgtaacattagcatgtgattatgtgtcatgtataacgttagttt |
10120024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 10120243 - 10120173
Alignment:
| Q |
1 |
caaagccagaatttgcaacaagtactgcaagaagcagattaaagatatggtatcttaaagaagacattgtt |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10120243 |
caaagccagaatttgcaacaagtactgcaagaagcagattaaagatatggtatcttaaagaagacattgtt |
10120173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University