View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18651_low_54 (Length: 214)
Name: NF18651_low_54
Description: NF18651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18651_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 30361322 - 30361133
Alignment:
| Q |
14 |
ataatactataacatgaaatgggaaattggataaaaagacaa---taaatacaactaatttatagaatgaagtta----tatggggatggctctggtgac |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30361322 |
ataatattataacatgaaatgggaaattggataacaagacaaaaataaatacaactaatttatagaatgaagttaatcatatggggatggctctggtgac |
30361223 |
T |
 |
| Q |
107 |
ttttgggtatacaacggtggcaggatgacccatgattctgcgacctttcctatgcttaaagatataaacaagagccccaaccggccattc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30361222 |
ttttgggtatacaacggtggcaggatgacccatgattctgcgacccttcctatgcttaaagatataaacaagagccccaaccggccattc |
30361133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 21 - 193
Target Start/End: Complemental strand, 30356717 - 30356539
Alignment:
| Q |
21 |
tataacatgaaatgggaaattggataaaaagacaa--taaatacaactaatttatagaatgaagtta----tatggggatggctctggtgacttttgggt |
114 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
30356717 |
tataacatgaaatgggaaattgggttaaaagacaaaataaatacaactaatttatagaatgaagttaatcatatggggatggctctgttgacttttgggt |
30356618 |
T |
 |
| Q |
115 |
atacaacggtggcaggatgacccatgattctgcgacctttcctatgcttaaagatataaacaagagccccaaccggcca |
193 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30356617 |
atacaacagtggcaggatgacccatgattctgcgacccttcttatgcttaaagatataaacaagggccccaaccggcca |
30356539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University