View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18652_low_13 (Length: 317)
Name: NF18652_low_13
Description: NF18652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18652_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 199 - 302
Target Start/End: Complemental strand, 5014990 - 5014887
Alignment:
| Q |
199 |
tgactttgtataaaggtttgtcgattaggttgtttcaaaatggttgtcaaaactcaacattatttctcattttgaatggatgtatgtttttaaattgtgg |
298 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
5014990 |
tgactctgtatgaaggtttgtcgattaggttgtttcaaaatggttgtcaaaactcaacattatttcttattttgaatggatgtatgattttaaattgtgg |
5014891 |
T |
 |
| Q |
299 |
ttac |
302 |
Q |
| |
|
|||| |
|
|
| T |
5014890 |
ttac |
5014887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 9 - 58
Target Start/End: Complemental strand, 5015046 - 5014997
Alignment:
| Q |
9 |
acatcatcaagataaaaatatttagaatggttagcatgatgtaaattgtt |
58 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5015046 |
acatcataaagataaaaatatttagaatggttagcatgatgtaaattgtt |
5014997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University