View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18652_low_14 (Length: 282)
Name: NF18652_low_14
Description: NF18652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18652_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 20 - 274
Target Start/End: Original strand, 31456354 - 31456608
Alignment:
| Q |
20 |
ttcatcccttttccgattagtataattcatttctaaaaccagtaattctcgttgtttacggtcatttctgaatcttctgcaggaatcagtaacaataaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||||| ||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
31456354 |
ttcatcccttttccgattagtataattcatttttaaaaccagtcattttcgttgtttacgatcatttctgaatcctctgtaggaatcagtaacaataaga |
31456453 |
T |
 |
| Q |
120 |
gtggttttgatagccttgttgaggcagctaccgtggcttcacagaaatttaatactactcaacagcaaggaattattctagatgcacttgatagagcttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31456454 |
gtggttttgatagccttgttgaggcagctaccgtggcttcacagaaatttaatactactcaacagcaaggaattattctagatgcacttgatagagcttt |
31456553 |
T |
 |
| Q |
220 |
tccaaaaccaatactttcagtggtgagttcattacaattttgtgtcatattcttc |
274 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31456554 |
tccaaagccaatactttcagtggtgagttcattacaattttgtgtcatattcttc |
31456608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 97 - 188
Target Start/End: Complemental strand, 38465326 - 38465235
Alignment:
| Q |
97 |
tgcaggaatcagtaacaataagagtggttttgatagccttgttgaggcagctaccgtggcttcacagaaatttaatactactcaacagcaag |
188 |
Q |
| |
|
||||||| |||| |||||||||||||| | ||| |||||||||||||||||||| |||| ||||||||||||| ||| |||||| |||| |
|
|
| T |
38465326 |
tgcaggactcagaaacaataagagtggctatgagagccttgttgaggcagctactatggcaaaacagaaatttaatgctattcaacaacaag |
38465235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University