View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18653_high_13 (Length: 313)
Name: NF18653_high_13
Description: NF18653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18653_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 184 - 307
Target Start/End: Complemental strand, 47318944 - 47318821
Alignment:
| Q |
184 |
ggaggggtatgtgacgattaattaannnnnnnaatgttgctattttgactactcctactcgttactcactaccactacgtatgtaaaatagtcgttagtg |
283 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47318944 |
ggaggggtatatgacgattaattaatttttttaatgttgctattttgactactcctactcgttactcactaccactacgtatgtaaaatagtcgttagtg |
47318845 |
T |
|
| Q |
284 |
ttgtgttgctatgaaacaaatttt |
307 |
Q |
| |
|
|||||||||||| || |||||||| |
|
|
| T |
47318844 |
ttgtgttgctattaatcaaatttt |
47318821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 26 - 92
Target Start/End: Complemental strand, 47319102 - 47319036
Alignment:
| Q |
26 |
ccgagactgcagctaaaaattgtaaaatataaaataagtgttggtcttaatgttcattattttccac |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47319102 |
ccgagactgcagctaaaaattgtaaaatataaaataagtgttggtcttaatgttcattattttccac |
47319036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University