View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18653_low_21 (Length: 267)
Name: NF18653_low_21
Description: NF18653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18653_low_21 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 2223524 - 2223779
Alignment:
| Q |
1 |
taattctcataaagaaaatatgtacaccgaattggttaattagtttagttagtcatatatcatacatgtatatatgcatattgcttatctaacaagtaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223524 |
taattctcataaagaaaatatgtacaccgaattggttaattagtttagttagtcatatatcatacatgtatatatgcatattgcttatctaacaagtaat |
2223623 |
T |
|
| Q |
101 |
taactagaataatagtttgnnnnnnnnnnaattaagaagcaaaatacatttatggtatttgaactgcttttggtaccatatcaaacactttgttttggct |
200 |
Q |
| |
|
||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
2223624 |
taaatagaataatggtttgttttttttttaattaagaagcaaaatacatttatggtatttgaactgcttttggtaccatatccaacaatt---------- |
2223713 |
T |
|
| Q |
201 |
gaattattattatttaatgatgatcgatcagccagatcttccggatgaaagagaaaggattgaagca |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223714 |
-aattattattatttaatgatgatcgatcagccagatcttccggatgaaagagaaaggattgaagca |
2223779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University