View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18653_low_5 (Length: 412)
Name: NF18653_low_5
Description: NF18653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18653_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 382; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 9 - 394
Target Start/End: Complemental strand, 43195103 - 43194718
Alignment:
| Q |
9 |
acatcatcactcaccaccttccttgtgacgctgacggtgtatgcatggtctgcaaacaaaaaccatcagaaaccgaaacacttcattgcaaaacctgcac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43195103 |
acatcatcactcaccaccttccttgtgacgctgacggtgtatgcatggtttgcaaacaaaaaccatcagaaaccgaaacacttcattgcaaaacctgcac |
43195004 |
T |
 |
| Q |
109 |
aacaccatggcatgctccttgtctccctgttgttccaacaacaagtgaaatgctcgattggttgtgtcctgattgtgctcaaccaagtgatgttgttgct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43195003 |
aacaccatggcatgctccttgtctccctgttgttccaacaacaagtgaaatgctcgattggttgtgtcctgattgtgctcaaccaagtgatgttgttgct |
43194904 |
T |
 |
| Q |
209 |
gcttctgctgctccgtctgttgcgggggatcttgtctctgctattcgcgctatcgagaatgatccttcgttgacggaggaagagaagagaaagaaacgcc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43194903 |
gcttctgctgctccgtctgttgcgggggatcttgtctctgctattcgcgctatcgagaatgatccttcgttgacggaggaagagaagagaaagaaacgcc |
43194804 |
T |
 |
| Q |
309 |
aagagttacatggtggatctttgaaagagaaggatgaggttcatgttaggagaagtggtgttcttgatatctttgatgggagtctt |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43194803 |
aagagttacatggtggatctttgaaagagaaggatgaggttcatgttaggagaagtggtgttcttgatatctttgatgggagtctt |
43194718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University