View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18654_high_22 (Length: 290)
Name: NF18654_high_22
Description: NF18654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18654_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 48416704 - 48416476
Alignment:
| Q |
19 |
agcaggcaattttcatattattagatctcgatcattaattaaaattcgaacggttcaaattaatatagttataaaatctttctaaacggtctcaatcaca |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48416704 |
agcacgcaattttcatattattagatctcgatcattaattaaaattcgaccggttcaaattaatatagttataaaatctttctaaacgatctcaatcaca |
48416605 |
T |
|
| Q |
119 |
tgttttagattggatggtcttgatttgttacgtgttacaacatctcatctatctatgatgttaataattatgactttactttatgggattcaacaccttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48416604 |
tgttttagattggatggtcttgatttgttacgtgttacaacatcccatctatctatggtgttaataattatggctttactttatgggattcaacaccttc |
48416505 |
T |
|
| Q |
219 |
gtttattttgacagattgaataaaaattg |
247 |
Q |
| |
|
||||||||||||||||| | ||||||||| |
|
|
| T |
48416504 |
gtttattttgacagattaattaaaaattg |
48416476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 43 - 149
Target Start/End: Complemental strand, 35003536 - 35003430
Alignment:
| Q |
43 |
atctcgatcattaattaaaattcgaacggttcaaattaatatagttataaaatctttctaaacggtctcaatcacatgttttagattggatggtcttgat |
142 |
Q |
| |
|
||||||| ||||||||||| | ||| ||||||||| ||| | |||||||||| ||| || | |||||| |||||||||||||| ||||| || |||| |
|
|
| T |
35003536 |
atctcgaccattaattaaagattgaatggttcaaatcaatgcaattataaaatcattcaaaccaatctcaaccacatgttttagatcggatgatcctgat |
35003437 |
T |
|
| Q |
143 |
ttgttac |
149 |
Q |
| |
|
||||||| |
|
|
| T |
35003436 |
ttgttac |
35003430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University