View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18654_high_38 (Length: 226)
Name: NF18654_high_38
Description: NF18654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18654_high_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 6 - 219
Target Start/End: Complemental strand, 44406084 - 44405871
Alignment:
| Q |
6 |
atatttattcttgtactcaatgcttttcggagttaggattaaatctacttctttttaataaaaatgataaggatccactttcatacttttttgagagtgc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44406084 |
atatttattcttgtactcaatgcttttcggagttaggattaaatctacttctttttaataaaaatgataaggatccactttcatacttttttgagagtgc |
44405985 |
T |
|
| Q |
106 |
agtaggcaaaccctaacattgttgaaggataaggaaaataaagttttgataaaatgagatatggaaataataacaataaacatattgaagctagtttaaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44405984 |
agtaggcaaaccctaacattgttgaaggataaggaaaataaagttttgataaaatgagatatggaaataataacaataaacatattgaagctagtttaaa |
44405885 |
T |
|
| Q |
206 |
gttgcttatatttt |
219 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44405884 |
gttgcttatatttt |
44405871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University