View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18654_low_26 (Length: 285)
Name: NF18654_low_26
Description: NF18654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18654_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 5e-65; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 140 - 269
Target Start/End: Original strand, 8138621 - 8138750
Alignment:
| Q |
140 |
ttatgagacaaatttatcgatctattttttaaaattttaagcacatacataattcttattaacaagaattaaatttctctctattttggttgagcagata |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8138621 |
ttatgagacaaatttatcgatctattttttaaaattttaagcacatacatagttcttattaacaagaattaaatttctctctattttggttgagcagata |
8138720 |
T |
|
| Q |
240 |
agatttgggaccatagcagtggtaatgtag |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8138721 |
agatttgggaccatagcagtggtaatgtag |
8138750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 52 - 150
Target Start/End: Original strand, 8138504 - 8138602
Alignment:
| Q |
52 |
gtgcaaataatgtgagattgcatgtttgaactcccgatcttgcatacgtatcaaatgtttatgtaaccatttttctatttgggttgtattatgagacaa |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||| |
|
|
| T |
8138504 |
gtgcaaataatgtgagattgcatgtttgaactcccgatcttgcatacgtatcaaatgtttatttagccattttcctatttgggttgtattatgagacaa |
8138602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 215 - 265
Target Start/End: Original strand, 8162740 - 8162790
Alignment:
| Q |
215 |
tctctctattttggttgagcagataagatttgggaccatagcagtggtaat |
265 |
Q |
| |
|
||||||| | ||| ||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
8162740 |
tctctctctcttgattgagcagaaaagattggggaccatagcagtggtaat |
8162790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University