View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18654_low_33 (Length: 249)
Name: NF18654_low_33
Description: NF18654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18654_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 23 - 230
Target Start/End: Original strand, 47826772 - 47826975
Alignment:
| Q |
23 |
ttcaccaaagttattattatatgctaggactaaacatttaaaattatcattttctcttatatctatctggtccctaataaactatcaaaatactcagtga |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47826772 |
ttcaccaaagttattattatatgctaggactaaacatttaaaattatcattttctcttatatc----tggtccctaataaactatcaaaatactcagtga |
47826867 |
T |
 |
| Q |
123 |
gctaacattatgttaaccatttacacaataatactagtaatagttcagagtatattacttattgatttaatgctaactttatgttttagtttgttagttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47826868 |
gctaacattatgttaaccatttacacaataataccagtaatagttcagagtatattacttattgatttaatgctaactttatgttttagtttgttagttc |
47826967 |
T |
 |
| Q |
223 |
atgctaat |
230 |
Q |
| |
|
|||||||| |
|
|
| T |
47826968 |
atgctaat |
47826975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University