View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18654_low_34 (Length: 246)
Name: NF18654_low_34
Description: NF18654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18654_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 228
Target Start/End: Complemental strand, 161757 - 161540
Alignment:
| Q |
14 |
aatatcaaagctcaaagaacccatatacaataacataccagcaatatataaaagaggtgcaaatagtaataagcctcttcttctgaaaatagctgacata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
161757 |
aatatcaaagctcaaagaacccatatacaataacataccagcaatatataaaagaggtgcaaatagtaataagcctcttcttctgaaaatagctgacata |
161658 |
T |
|
| Q |
114 |
aaaagatatacaaatttggaccatgatgatgatgatttggaggaaaaggaggagg---aggaagattttccaccaccgatgacgccgccgctcttactcc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
161657 |
aaaagatatacaaatttggaccatgatgatgatgatttggaggaaaaggaggaggaggaggaggattttccaccaccgatgacgccgccgctcttactcc |
161558 |
T |
|
| Q |
211 |
ttcccaagcggctgtacc |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
161557 |
ttcccaagcggctgtacc |
161540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University