View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18654_low_37 (Length: 237)
Name: NF18654_low_37
Description: NF18654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18654_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 19 - 202
Target Start/End: Complemental strand, 19506328 - 19506155
Alignment:
| Q |
19 |
gtctgatctcccgagcgtcgatggtcgaagagattatgatatcaggtcgtacctttttaactcttatttttcgattgatccttctgtcaaaattgctaaa |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| | ||| ||||||||||||||||||| |
|
|
| T |
19506328 |
gtctgatctcccgagcgtcggtggtcgaagagattatgatatcaggtcgtacctttctaactctattattt----------ttctgtcaaaattgctaaa |
19506239 |
T |
 |
| Q |
119 |
gcgataaagattacaatcagtttttgtccttctgtgctttcatttacgaaaacaaatttagttttcggcatgaattcggtttcg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506238 |
gcgataaagattacaatcagtttttgtccttctgtgcttttatttacgaaaacaaatttagttttcggcatgaattcggtttcg |
19506155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 140 - 206
Target Start/End: Original strand, 20568697 - 20568763
Alignment:
| Q |
140 |
ttttgtccttctgtgctttcatttacgaaaacaaatttagttttcggcatgaattcggtttcggcta |
206 |
Q |
| |
|
|||||| |||||||| ||| ||| ||||||| ||||||||||||| || |||||| ||||||||||| |
|
|
| T |
20568697 |
ttttgttcttctgtggtttaattcacgaaaataaatttagttttcagcctgaatttggtttcggcta |
20568763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 136
Target Start/End: Original strand, 20568550 - 20568667
Alignment:
| Q |
22 |
tgatctcccgagcgtcgatggtcgaagagattatgatatcaggtcgtacctttttaactc--ttatttttcgattgatccttctgtc--aaaattgctaa |
117 |
Q |
| |
|
||||||||||| ||| | |||| |||||| |||||||||||||| |||||| | |||||| ||||||||| ||| |||| ||| || ||| || ||| |
|
|
| T |
20568550 |
tgatctcccga-cgttggtggttgaagaggttatgatatcaggttgtacctatctaactctgttatttttcaattaatccctctatcgagaaagtgttaa |
20568648 |
T |
 |
| Q |
118 |
agcgataaagattacaatc |
136 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
20568649 |
agggataaagattacaatc |
20568667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University