View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18654_low_39 (Length: 226)

Name: NF18654_low_39
Description: NF18654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18654_low_39
NF18654_low_39
[»] chr2 (1 HSPs)
chr2 (6-219)||(44405871-44406084)


Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 6 - 219
Target Start/End: Complemental strand, 44406084 - 44405871
Alignment:
6 atatttattcttgtactcaatgcttttcggagttaggattaaatctacttctttttaataaaaatgataaggatccactttcatacttttttgagagtgc 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44406084 atatttattcttgtactcaatgcttttcggagttaggattaaatctacttctttttaataaaaatgataaggatccactttcatacttttttgagagtgc 44405985  T
106 agtaggcaaaccctaacattgttgaaggataaggaaaataaagttttgataaaatgagatatggaaataataacaataaacatattgaagctagtttaaa 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44405984 agtaggcaaaccctaacattgttgaaggataaggaaaataaagttttgataaaatgagatatggaaataataacaataaacatattgaagctagtttaaa 44405885  T
206 gttgcttatatttt 219  Q
    ||||||||||||||    
44405884 gttgcttatatttt 44405871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University