View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18654_low_40 (Length: 212)
Name: NF18654_low_40
Description: NF18654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18654_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 2598137 - 2598318
Alignment:
| Q |
14 |
aaaatgtgtaagctaaacaacacataatctacttccttgttaacacaatccagattttataattcaaactgtttattaaaggtttagtttatacactata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2598137 |
aaaatgtgtaagctaaacaacacataatctacttccttgttaacacaattcagattttataatccaaactatttattaaaggtttagtttatacactata |
2598236 |
T |
 |
| Q |
114 |
aaatttgaactctttattgaagattcagtatatacactataatctatctctaaaataatcttttaggatgtttaaaacattt |
195 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2598237 |
aaatttgaactctttattaaagattcactatatacattataatctatctctaaaataatcttttaggatgtttgaaacattt |
2598318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University