View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18655_high_39 (Length: 224)
Name: NF18655_high_39
Description: NF18655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18655_high_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 2 - 212
Target Start/End: Complemental strand, 41310953 - 41310743
Alignment:
| Q |
2 |
aattgtggcgatattcttggaccagctaatggtggattagttaagcttaatgtcaaaggacaactgctaaagtatcactcctatagtgaccgttgcttta |
101 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41310953 |
aattgtggcgatattgttggaccagccaatggtggattagttaagcttaatgtcaaaggacaactgctaaagtatcactcctatagtgaccgttgcttta |
41310854 |
T |
 |
| Q |
102 |
tgagatcccaaatggcactgtatacagagtctctactttcactaaacttaagatgactagtgataccaaactagaagaatttgattgtgaaattttggta |
201 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41310853 |
tgagatcccaaatggcggtgtatacagagtctctactttcactaaacttaagatgactagtgataccaaactagaagaatttgattgtgaaatattggta |
41310754 |
T |
 |
| Q |
202 |
tttatcatttt |
212 |
Q |
| |
|
||||||||||| |
|
|
| T |
41310753 |
tttatcatttt |
41310743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 148 - 194
Target Start/End: Complemental strand, 43164465 - 43164419
Alignment:
| Q |
148 |
cttaagatgactagtgataccaaactagaagaatttgattgtgaaat |
194 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43164465 |
cttaagatgaccagtgataacaaactagaagaatttgattgtgaaat |
43164419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 31 - 144
Target Start/End: Original strand, 30165994 - 30166107
Alignment:
| Q |
31 |
tggtggattagttaagcttaatgtcaaaggacaactgctaaagtatcactcctatagtgaccgttgctttatgagatcccaaatggcactgtatacagag |
130 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| | ||||||| |||||| ||||||||| ||||||||||||||||||||| |||||| |||| |
|
|
| T |
30165994 |
tggtggattagcaaagcttaatgacaaaggacaactgcaagagtatcattcctatggtgaccgttactttatgagatcccaaatggcggtgtatatagag |
30166093 |
T |
 |
| Q |
131 |
tctctactttcact |
144 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
30166094 |
tctctgctttcact |
30166107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University