View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18655_low_24 (Length: 301)

Name: NF18655_low_24
Description: NF18655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18655_low_24
NF18655_low_24
[»] chr6 (1 HSPs)
chr6 (137-283)||(33965641-33965788)
[»] chr8 (1 HSPs)
chr8 (165-242)||(43077381-43077458)


Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 137 - 283
Target Start/End: Original strand, 33965641 - 33965788
Alignment:
137 aatgtagaaaaatagaaagtattttttgg-ttacatactttgaatgtgatgttcttagcaatgaaataaggtgaattaactgcaaaagttgctgaaccat 235  Q
    ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
33965641 aatgtagaaaaatagaaagtagtttttgggttacatactttgaatgtgatgttcttggcaatgaaataaggtgaattaactgcaaaagttgctgaaccat 33965740  T
236 atgttcccaatggattccctcttggaccaggtgttgcagcagtgtcac 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
33965741 atgttcccaatggattccctcttggaccaggtgttgcagcagtgtcac 33965788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 165 - 242
Target Start/End: Complemental strand, 43077458 - 43077381
Alignment:
165 gttacatactttgaatgtgatgttcttagcaatgaaataaggtgaattaactgcaaaagttgctgaaccatatgttcc 242  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||||    
43077458 gttacttactttgaatgtgatgttcttagcaatgaaataaggtgaattcactgcaaaagttgccgaaccataagttcc 43077381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University