View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18655_low_33 (Length: 250)

Name: NF18655_low_33
Description: NF18655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18655_low_33
NF18655_low_33
[»] chr6 (2 HSPs)
chr6 (169-234)||(10551351-10551416)
chr6 (1-53)||(10551419-10551471)


Alignment Details
Target: chr6 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 169 - 234
Target Start/End: Complemental strand, 10551416 - 10551351
Alignment:
169 agaacaaggtttcataggagaagaaatggagtcagaagatcaagctacaaataaaagaatgaaaga 234  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10551416 agaaaaaggtttcataggagaagaaatggagtcagaagatcaagctacaaataaaagaatgaaaga 10551351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 10551471 - 10551419
Alignment:
1 aattgaacattgagcgtgccaaattataaaaaatttacttgagaaaatacata 53  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||    
10551471 aattgaacattgagcgtcccaaattataaaaaatttacttgagaaaatacata 10551419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University