View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18655_low_43 (Length: 232)
Name: NF18655_low_43
Description: NF18655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18655_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 32366613 - 32366817
Alignment:
| Q |
17 |
aagtaacacaaacggtaatattccaaatcctaagtcctaacttatctgaaaccatatcacagttggagggactgtccct------gtgatgtggtttcgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||| |||||| ||||| | ||||| | |
|
|
| T |
32366613 |
aagtaacacaaacggtaatattccaaatcctaagtcctaacttatatgaaaccataa-acacttggagggacagtccctccaaatgtgatattgtttcat |
32366711 |
T |
 |
| Q |
111 |
caaatgttaatttgtcttttctgcaatggccttttgaacctgaaaaatgtgtcttgcaattaggtggtaggagacaacacaacacctcggctttgatacc |
210 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32366712 |
caaatgttaagttgtcttttctgcaatggccttttgaacctgaaaaatgtgtcttgcaattaggtggtaggagacaacacaacacctcggctttgatacc |
32366811 |
T |
 |
| Q |
211 |
gatatt |
216 |
Q |
| |
|
|||||| |
|
|
| T |
32366812 |
gatatt |
32366817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 32319745 - 32319937
Alignment:
| Q |
17 |
aagtaacacaaacggtaatattccaaatcctaagtcctaacttatctgaaaccatatcacagttggagggactgtccctgtgatgtggtttcgtcaaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||| ||||||||||||||| ||||||| | ||||| ||||||||||||| |||||||| |
|
|
| T |
32319745 |
aagtaacacaaacggtaatattcccaatcct-------aacttatttgaaaccatatcacacttggaggcattgtccttgtgatgtggttttgtcaaatg |
32319837 |
T |
 |
| Q |
117 |
ttaatttgtcttttctgcaatggccttttgaacctgaaaaatgtgtcttgcaattaggtggtaggagacaacacaacacctcggctttgataccgatatt |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32319838 |
ttaatttgtcttttctgcaaccgccttttgaacacgaaaaatgtgtcttgcaattaggtggtgggagacaacacaacacctcgactttgataccgatatt |
32319937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University