View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18655_low_48 (Length: 221)
Name: NF18655_low_48
Description: NF18655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18655_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 11 - 171
Target Start/End: Complemental strand, 39028352 - 39028195
Alignment:
| Q |
11 |
cacagagactggaatggacttccacattaccaaacctatcaagaaagagcatttactcaaagctattacatacatagagaatagtgacatattgtaatgn |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39028352 |
cacagagactggaatggacttccacattaccaaacctatcaagaaagagcatttacttaaagctattacatacatagagaatagtgacatattgtaagg- |
39028254 |
T |
 |
| Q |
111 |
nnnnnnnnnnnnnnatactctaggataaaggaagccttttaaccattttggttttcttctt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39028253 |
--ttttttttttttatactctaggataaaggaagccttttaaccattttggttttcttctt |
39028195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University