View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18657_high_17 (Length: 286)
Name: NF18657_high_17
Description: NF18657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18657_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 47206191 - 47205921
Alignment:
| Q |
1 |
agggtaaaatctctttcaaatttgcatggagtaactcatgtgataaccattttacaatactgtcatcattaactattgaatattgattattactctct-- |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47206191 |
agggtaaaatctctttcaaatttgcatggagtaactcatgtgataaccattttacaatactgtcatcattaactattgaatattgattattactctcttt |
47206092 |
T |
 |
| Q |
99 |
gtttcagataagcatagcattaaaacaggtctggcaactcttggtaatgttcatcaagaaaatagcaagagatataccttcaaatttggctactaacaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47206091 |
gtttcagataagcatagcattaaaacaggtctggcaactcttggtaatgttcatcaagaaaatagcaagagatataccttcaaatttggctactaacaat |
47205992 |
T |
 |
| Q |
199 |
tccaaaataacaatgatttagctgaatagagaacaataaatatgagttgcaagtggtgttgccaatcattt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47205991 |
tccaaaataacaatgatttagctgaatagagaacaataaatatgagttgcaagtggtgttgccaatcattt |
47205921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University