View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18657_high_21 (Length: 258)
Name: NF18657_high_21
Description: NF18657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18657_high_21 |
 |  |
|
| [»] scaffold0295 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 11 - 242
Target Start/End: Complemental strand, 2691810 - 2691580
Alignment:
| Q |
11 |
caaagggaaatcaagatagataatggaaaattatcttaatatttgatttatagaatagtctagggtactcttgatctctttagatattctttaagtttat |
110 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| || || |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2691810 |
caaaggggaatcaagatagataatggaaaattatcatattacctgatttatagaacagtctaggatactcttgatctctttagatattctttaagtttat |
2691711 |
T |
 |
| Q |
111 |
caacatgctctctgaaaaaacattttaaaatgtaccaactatcgaatttccgatgacaaaatatccttgaaacccagtttcacttcagcaacatgagtca |
210 |
Q |
| |
|
|||||| ||||||||||||| | ||| ||||| ||||| || ||| | ||| |||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
2691710 |
caacatcctctctgaaaaaata-tttcaaatgcaccaatcattgaactcccggtgacaaaatatcctcgaaatccagtttcacttcagcaacatgagtca |
2691612 |
T |
 |
| Q |
211 |
tcacatttaccttgtatggatagagtaagaaa |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2691611 |
tcacatttaccttgtatggatagagtaagaaa |
2691580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0295 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0295
Description:
Target: scaffold0295; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 6624 - 6666
Alignment:
| Q |
181 |
aacccagtttcacttcagcaacatgagtcatcacatttacctt |
223 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
6624 |
aacccaatttcacttcagcaacatgagtcaacacgtttacctt |
6666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University