View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18657_high_24 (Length: 218)
Name: NF18657_high_24
Description: NF18657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18657_high_24 |
 |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0006 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 25 - 204
Target Start/End: Original strand, 82515 - 82698
Alignment:
| Q |
25 |
aataaaagaaatgcagtaagaatcagactaataatataagggagggactagagaattaccgagatagaaggagaattacatcacaca----tacttcata |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||| |
|
|
| T |
82515 |
aataaaagaaatgcagtaagaatcagactaataatataagggagggactagagaattagtgagatagaaggagaattacatcactcacgcatacttcata |
82614 |
T |
 |
| Q |
121 |
accctttttctcatctctttgtaagatatctacccatgtagtcactaaaatgtgatggttatctttaggaatacagttgtttct |
204 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
82615 |
accatttttctcatctctttgtaagatatctacccatgtagtcaataaaatgtgatggttatgtttaggaatacagttgtttct |
82698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University