View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18657_low_15 (Length: 381)
Name: NF18657_low_15
Description: NF18657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18657_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 16 - 362
Target Start/End: Complemental strand, 13233513 - 13233167
Alignment:
| Q |
16 |
atcacactgatcatactcttgtatcacatcaatgagattctcaattggattctctcctttaggaacttttcgtcccattcggttcaaatggtgaccaaca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
13233513 |
atcacactgatcatactcttgtatcacatcaatgagattctcaattggattctctcctttaggaatttttcgtcccattcgattcaaatggtgaccaaca |
13233414 |
T |
 |
| Q |
116 |
tctttgagtgatccttgaaacatgagttgtcctctagcaaggatgatgagatggtcaagcagaagctgaattcttgatgaaggttggtggattgtgagaa |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13233413 |
tcttttagtgatccttgaaacatgagttgtcctctagcaaggatgatgagatggtcaagcagaagctggattcttgatgaaggttggtggattgtgagaa |
13233314 |
T |
 |
| Q |
216 |
taactgtgctaccatttcttgctatgtcatgtagtttttcgatcacactaagagcacttgttgagtctagtcctgaagttggttcatctaggaaaaggag |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13233313 |
taactgtgctaccatttcttgctatgtcatgtagtttttcgatcacactaagagcacttgttgagtctagtcctgaagttggttcatctaggaaaaggag |
13233214 |
T |
 |
| Q |
316 |
tgaaggtccatggattatgtctacgccgattgagactctgcggcgct |
362 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13233213 |
tgaaggtccatggattatgtctacgccaattgagactctgcggcgct |
13233167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University