View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18657_low_16 (Length: 369)
Name: NF18657_low_16
Description: NF18657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18657_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 4e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 155 - 353
Target Start/End: Original strand, 8185911 - 8186107
Alignment:
| Q |
155 |
acctaaccctaaaatctcccactttcagaaa-cacaacgctttctctcagttcttcaaacaaattggtttcgttgtttcttccaactctctgcttcaatg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8185911 |
acctaaccctaaaatctcccactttcagaaaacacaacgctttctctcagttcttcaaacaaattggtttcgtt---tcttccaactctctgcttcaatg |
8186007 |
T |
|
| Q |
254 |
gattctgcatcacctttgttaaatttaccaaatggttgctgggactgtatctgcaaactcctcaccgacaccaacaacgatggcttcgaagactacaacc |
353 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8186008 |
gattctgcatcacctttgttaaatttaccgaatggttgctgggactgtatctgcaaactcctcaccgacaccaacaacgaaggcttcgaagactacaacc |
8186107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 9 - 99
Target Start/End: Original strand, 48976606 - 48976696
Alignment:
| Q |
9 |
gaagaatatcaaatcgattgaaacggagaatgtttgtgtctgtattttgtggaaccgaaacccttcctttcagctttaaaacggtgtctct |
99 |
Q |
| |
|
|||||| ||| |||||||||||||| ||| ||||||||| |||||||||||||| ||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
48976606 |
gaagaaaatcgaatcgattgaaacgaagagtgtttgtgtatgtattttgtggaatcgaaacccttccttttagctttaaaacagtgtctct |
48976696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 39 - 94
Target Start/End: Complemental strand, 2213768 - 2213713
Alignment:
| Q |
39 |
tgtttgtgtctgtattttgtggaaccgaaacccttcctttcagctttaaaacggtg |
94 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2213768 |
tgtttgtgtttgtattgtgtggaaccgaaaccctttctttcagctttaaaacggtg |
2213713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 32119140 - 32119226
Alignment:
| Q |
8 |
cgaagaatatcaaatcgattgaaacggagaatgtttgtgtctgtattttgtggaaccgaaacccttcctttcagctttaaaacggtg |
94 |
Q |
| |
|
||||||| ||| ||||| |||||||| ||| ||||||||||||||||| |||||||| ||||| || ||||| |||||| ||||||| |
|
|
| T |
32119140 |
cgaagaaaatcgaatcgtttgaaacgaagagtgtttgtgtctgtatttagtggaaccaaaaccttttctttctgctttataacggtg |
32119226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University