View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18657_low_25 (Length: 258)

Name: NF18657_low_25
Description: NF18657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18657_low_25
NF18657_low_25
[»] chr1 (1 HSPs)
chr1 (11-242)||(2691580-2691810)
[»] scaffold0295 (1 HSPs)
scaffold0295 (181-223)||(6624-6666)


Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 11 - 242
Target Start/End: Complemental strand, 2691810 - 2691580
Alignment:
11 caaagggaaatcaagatagataatggaaaattatcttaatatttgatttatagaatagtctagggtactcttgatctctttagatattctttaagtttat 110  Q
    ||||||| ||||||||||||||||||||||||||| || ||  |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||    
2691810 caaaggggaatcaagatagataatggaaaattatcatattacctgatttatagaacagtctaggatactcttgatctctttagatattctttaagtttat 2691711  T
111 caacatgctctctgaaaaaacattttaaaatgtaccaactatcgaatttccgatgacaaaatatccttgaaacccagtttcacttcagcaacatgagtca 210  Q
    |||||| ||||||||||||| | ||| ||||| |||||  || ||| | ||| |||||||||||||| |||| |||||||||||||||||||||||||||    
2691710 caacatcctctctgaaaaaata-tttcaaatgcaccaatcattgaactcccggtgacaaaatatcctcgaaatccagtttcacttcagcaacatgagtca 2691612  T
211 tcacatttaccttgtatggatagagtaagaaa 242  Q
    ||||||||||||||||||||||||||||||||    
2691611 tcacatttaccttgtatggatagagtaagaaa 2691580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0295 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0295
Description:

Target: scaffold0295; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 6624 - 6666
Alignment:
181 aacccagtttcacttcagcaacatgagtcatcacatttacctt 223  Q
    |||||| ||||||||||||||||||||||| ||| ||||||||    
6624 aacccaatttcacttcagcaacatgagtcaacacgtttacctt 6666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University