View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18657_low_26 (Length: 255)
Name: NF18657_low_26
Description: NF18657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18657_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 57 - 235
Target Start/End: Original strand, 2035709 - 2035888
Alignment:
| Q |
57 |
tccaccacattcaatttatcattgaa-ctgcaaaatttgggagtcgatttacataagcacttcatacatctctcccaactttattggttttgtttaactg |
155 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2035709 |
tccaccacattcaatttatcattgaaactgcaaaatttgggagtcgatttacataagcacttcatacatctctcccaactttattggttttgtttaactg |
2035808 |
T |
|
| Q |
156 |
ttatatgttgcttcaataacaaaggtttaacgagattttcattatctcttggatgatcaaattcatcttattttcgtgat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2035809 |
ttatatgttgcttcaataacaaaggtttaacgagattttcattatctcttggatgatcaaattcatcttattttcgtgat |
2035888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University