View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18657_low_28 (Length: 218)

Name: NF18657_low_28
Description: NF18657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18657_low_28
NF18657_low_28
[»] scaffold0006 (1 HSPs)
scaffold0006 (25-204)||(82515-82698)


Alignment Details
Target: scaffold0006 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 25 - 204
Target Start/End: Original strand, 82515 - 82698
Alignment:
25 aataaaagaaatgcagtaagaatcagactaataatataagggagggactagagaattaccgagatagaaggagaattacatcacaca----tacttcata 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||| ||    |||||||||    
82515 aataaaagaaatgcagtaagaatcagactaataatataagggagggactagagaattagtgagatagaaggagaattacatcactcacgcatacttcata 82614  T
121 accctttttctcatctctttgtaagatatctacccatgtagtcactaaaatgtgatggttatctttaggaatacagttgtttct 204  Q
    ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||    
82615 accatttttctcatctctttgtaagatatctacccatgtagtcaataaaatgtgatggttatgtttaggaatacagttgtttct 82698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University