View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18658_high_17 (Length: 238)
Name: NF18658_high_17
Description: NF18658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18658_high_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 21510651 - 21510431
Alignment:
| Q |
18 |
atatttgactgcgattttctgcaatatcaaatatcgcactgcagccactatttaaattcctgatatttacattattcatgtcataccttaactttcttag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21510651 |
atatttgactgcgattttctgcaatatcaaatatcgcactgcagccactatttaaattcctgatatttacattattcatgtcataccttaactttcttag |
21510552 |
T |
 |
| Q |
118 |
taatggaatagacgaagggcttgatataaactttggatccattgaacttgaagtaaacataaccaaattcttgtaaggaccaatatccctaggaatggac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21510551 |
taatggaatagacgaagggcttgatataaactttggatccattgaacttgaagtaaacataaccaaattcttgtaaggaccaatatccctaggaatggac |
21510452 |
T |
 |
| Q |
218 |
tcttctgaatcaaagatacca |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
21510451 |
tcttctgaatcaaagatacca |
21510431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 54
Target Start/End: Original strand, 9412540 - 9412576
Alignment:
| Q |
18 |
atatttgactgcgattttctgcaatatcaaatatcgc |
54 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
9412540 |
atatttgactgtgattttctgcaatatcaattatcgc |
9412576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University