View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18658_high_8 (Length: 292)
Name: NF18658_high_8
Description: NF18658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18658_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 62
Target Start/End: Complemental strand, 28280846 - 28280797
Alignment:
| Q |
13 |
aatatacaggaacctctaagtctacagtgagtgaggaaaatatagggttt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28280846 |
aatatacaggaacctctaagtctacagtgagtgaggaaaatatagggttt |
28280797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University