View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18658_low_20 (Length: 237)
Name: NF18658_low_20
Description: NF18658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18658_low_20 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 11111919 - 11111696
Alignment:
| Q |
16 |
agtactacttgtagttgtacttattcatctttgttataataattttctctttgttgttaaaaagaaaaacacagaaagagcttgtgacagaaagaaagga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11111919 |
agtactacttgtagttgtacttattcatctttgttataataattttctctttgttgttaaaaa---aaacacagaaagagcttgtgacagaaagaaagga |
11111823 |
T |
|
| Q |
116 |
ttttataatgaaacttacattgaaagaaggttatcttacacacataaagcacgaaaaatacagtatagctcatgacacaaatgtgct-----agcacttc |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
11111822 |
ttttataatgaaaattacattgaaagaaggttatcttacacacataaaacacgtaaaatacagtatacctcatgacacaaatgtgcttagccagcacttc |
11111723 |
T |
|
| Q |
211 |
tctttattagtgaattccaatcaccac |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
11111722 |
tctttattagtgaattccaatcaccac |
11111696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 200 - 237
Target Start/End: Complemental strand, 11119505 - 11119468
Alignment:
| Q |
200 |
gctagcacttctctttattagtgaattccaatcaccac |
237 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11119505 |
gctagcacttttctttattagtgaattccaatcaccac |
11119468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University