View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18659_low_24 (Length: 247)

Name: NF18659_low_24
Description: NF18659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18659_low_24
NF18659_low_24
[»] chr7 (1 HSPs)
chr7 (46-200)||(2494879-2495036)


Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 46 - 200
Target Start/End: Complemental strand, 2495036 - 2494879
Alignment:
46 tcaacaacatcaatagcaccaaccatattaacagcatctacaacaaccttaactaaatcaccagaacaaca---tgaaactgaaacacccacaacaaaat 142  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||    
2495036 tcaacaacatcaatagcaccaaccatattaacagcatctacaacaaccttaactaaatcaccagaacaacaacatgaaactgaaacacccacaacaaaat 2494937  T
143 tcacaacctcaacaaccccaaaaatctcacctttttcaaatggtgttctcaaacgttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2494936 tcacaacctcaacaaccccaaaaatctcacctttttcaaatggtgttctcaaacgttt 2494879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University