View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18659_low_24 (Length: 247)
Name: NF18659_low_24
Description: NF18659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18659_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 46 - 200
Target Start/End: Complemental strand, 2495036 - 2494879
Alignment:
| Q |
46 |
tcaacaacatcaatagcaccaaccatattaacagcatctacaacaaccttaactaaatcaccagaacaaca---tgaaactgaaacacccacaacaaaat |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2495036 |
tcaacaacatcaatagcaccaaccatattaacagcatctacaacaaccttaactaaatcaccagaacaacaacatgaaactgaaacacccacaacaaaat |
2494937 |
T |
|
| Q |
143 |
tcacaacctcaacaaccccaaaaatctcacctttttcaaatggtgttctcaaacgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2494936 |
tcacaacctcaacaaccccaaaaatctcacctttttcaaatggtgttctcaaacgttt |
2494879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University