View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18659_low_30 (Length: 222)
Name: NF18659_low_30
Description: NF18659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18659_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 38 - 206
Target Start/End: Original strand, 36875149 - 36875315
Alignment:
| Q |
38 |
acatctggagatacagtacattgtagttggttgactctgttgtctgattttaaccaaacaaggcaatatagttggggatgagcagttttggctatcctat |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
36875149 |
acatctggagatacagtacattgtagttggttgactctgttgtctgattttaaccaaacaaggcaatatagttggggatcagcagttttggctaccctat |
36875248 |
T |
|
| Q |
138 |
atcgaggcatgtgcgaagcatcacatcacaagctgggtatgcaactctgtcctgatgtacttttcttct |
206 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36875249 |
a--gaggcatgtgcgaagcatcacatcacaagctgggtatgcaactctgtcctgatgtacttttcttct |
36875315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University