View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1865_high_15 (Length: 205)
Name: NF1865_high_15
Description: NF1865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1865_high_15 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 34812959 - 34813163
Alignment:
| Q |
1 |
gttttattatcaaagcattaattttcagaatggttagtacctagtacttagtagtactacttgactataannnnnnnnnngaggtgaaccttggggagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34812959 |
gttttattatcaaagcattaattttcagaatggttagtacctagtacttagtagtactacttgactataattttttttttgaggtgaaccttggggagac |
34813058 |
T |
|
| Q |
101 |
ccagttccatagagcggtttgcatagcccaaggtccggccctggcaggtaatgtactggtagagagtctagcaacaatcttttttggtcatgatgagttc |
200 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34813059 |
ccagttccatagagcggtttgcataccctaaggtccggccctggcagatagtgtactggtagagagtctagcaacaatcttttttggtcatgatgagttc |
34813158 |
T |
|
| Q |
201 |
aaatc |
205 |
Q |
| |
|
||||| |
|
|
| T |
34813159 |
aaatc |
34813163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 143
Target Start/End: Original strand, 39332586 - 39332640
Alignment:
| Q |
89 |
ccttggggagatccagttccatagagcggtttgcatagcccaaggtccggccctg |
143 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| | ||||||||||| ||||| |
|
|
| T |
39332586 |
ccttggggatgtccagttccattgagcggtttgcacatcccaaggtccgaccctg |
39332640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 5892905 - 5892866
Alignment:
| Q |
1 |
gttttattatcaaagcattaattttcagaatggttagtac |
40 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
5892905 |
gttttattatcagagcactaattttcagaatggttagtac |
5892866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 28580441 - 28580403
Alignment:
| Q |
1 |
gttttattatcaaagcattaattttcagaatggttagta |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
28580441 |
gttttattatcaaagcattaatttccagaatggtaagta |
28580403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 140
Target Start/End: Original strand, 17322705 - 17322757
Alignment:
| Q |
88 |
accttggggagatccagttccatagagcggtttgcatagcccaaggtccggcc |
140 |
Q |
| |
|
|||||||||||| || ||||||| |||||||||||| | || ||||||||||| |
|
|
| T |
17322705 |
accttggggagaccccgttccattgagcggtttgcacaccctaaggtccggcc |
17322757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University