View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1865_low_12 (Length: 242)
Name: NF1865_low_12
Description: NF1865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1865_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 60 - 226
Target Start/End: Original strand, 34815432 - 34815598
Alignment:
| Q |
60 |
gctttttcttttcatttgcatagtcaaacctgcatgatgtagtatagactgtgtgattgaagtttttctcactgaattcagtaaacagacctttgatgat |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34815432 |
gctttttcttttcatttgcatagtcaaacctgcatgatgtagtatacactgtgtgattgaagtttttctcactgaattcagtaaacagacctttgatgat |
34815531 |
T |
|
| Q |
160 |
cagatttgcgaaagtgcagcaggaatcagtttctctaattccataagttcggtcacactgaggtgct |
226 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34815532 |
cggatttgcgaaagtgcagcaggaatcagtttctctagttccataagttcggtcacactgaggtgct |
34815598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 34815374 - 34815413
Alignment:
| Q |
1 |
taaatcccagtcccataaagaatatattcattgcatcaca |
40 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34815374 |
taaatcccagtcccataaagaagatattcattgcatcaca |
34815413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University