View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1865_low_13 (Length: 234)
Name: NF1865_low_13
Description: NF1865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1865_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 19313772 - 19313568
Alignment:
| Q |
16 |
aaaagagcaggagaaaatagacgaaaagaattttcctcactattcaaacaaagatcacaaacagaagggatgctacagcctctttctttcaatttctcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19313772 |
aaaagagcaggagaaaatagacgaaaagaattttcctcactattcaaacaaagatcacaaacagaagggatgctacagcctctttctttcaatttctcat |
19313673 |
T |
 |
| Q |
116 |
tagtgaataacttatcatgcattactctccacactaagagggatttggaatgagggatatctttacaccaaatatccttagcccaatctaaagtctgaga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19313672 |
tagtgaataacttatcatgcattactctccacactaagagggatttggaatgagggatatctttacaccaaatatccttagcccaatctaaagtctgaga |
19313573 |
T |
 |
| Q |
216 |
attat |
220 |
Q |
| |
|
||||| |
|
|
| T |
19313572 |
attat |
19313568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University