View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18660_low_10 (Length: 356)
Name: NF18660_low_10
Description: NF18660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18660_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 5e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 13 - 168
Target Start/End: Complemental strand, 31279213 - 31279058
Alignment:
| Q |
13 |
aatatcttatttttggtgattaaaattcatatttttatcttggttttgctttctgaaacttgtcatggtttatttgaaaagacaacaattctggtgattt |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31279213 |
aatatcttatttttggtgattaaaaatcatatttttatcttggttttgctttctgaaacttgtcatggtttatttgaaaagacagcaattctggtgattt |
31279114 |
T |
 |
| Q |
113 |
cattttattttgacaggaagaatgttttcttgatgttcataatgttcttgatgcat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31279113 |
cattttattttgacaggaagaatgttttcttgatgttcataatgttcttgatgcat |
31279058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 248 - 340
Target Start/End: Complemental strand, 31278978 - 31278886
Alignment:
| Q |
248 |
ggcattgtctatttcgacaaatttgatgtattttcaatcactactttttgtgggtattagtaaatctttgcgggcaagaagcttggagaagga |
340 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31278978 |
ggcattgtctatttcgtcaaatttgatgtattttcaatcactactttttgtgggtattagtaaatctttgcgggcaagaagcttggagaagga |
31278886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University