View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18660_low_15 (Length: 272)

Name: NF18660_low_15
Description: NF18660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18660_low_15
NF18660_low_15
[»] chr4 (1 HSPs)
chr4 (2-251)||(17117193-17117440)
[»] chr7 (4 HSPs)
chr7 (146-249)||(7812113-7812216)
chr7 (191-249)||(6671772-6671830)
chr7 (185-249)||(21910206-21910270)
chr7 (125-249)||(22986739-22986863)
[»] chr5 (1 HSPs)
chr5 (178-249)||(25801716-25801787)
[»] scaffold0073 (1 HSPs)
scaffold0073 (191-249)||(41684-41742)
[»] chr1 (1 HSPs)
chr1 (179-249)||(160192-160262)
[»] scaffold0001 (1 HSPs)
scaffold0001 (185-251)||(150558-150624)
[»] chr2 (1 HSPs)
chr2 (189-249)||(32136422-32136482)


Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 2 - 251
Target Start/End: Complemental strand, 17117440 - 17117193
Alignment:
Q  2 aaacttcaaaagaaatggaagacaacaggatcttgaaccatgatgaccttaggtaaagggtattttgagttttcttttacctcatatattgatttacgtg 101  Q
    ||||||||||||||||||||||||||| ||||||| ||||||||  | |||||||| ||||||||||||||||||||||||||||||  |||||||| ||    
T  17117440 aaacttcaaaagaaatggaagacaacacgatcttggaccatgattgctttaggtaaggggtattttgagttttcttttacctcatat--tgatttacttg 17117343  T
Q  102 ttgtttggtcgatgggcactgttaatttgaaacaaggtgttttacggctttttgagtcgacaaaatatttcaatgcacatacacaacgaaacacgcatgc 201  Q
    |||||||| |  ||| ||| |||||||||||||   ||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||    
T  17117342 ttgtttggccattggacaccgttaatttgaaacctagtgttttacggctttttgagttgacaaaatatttcattgcacatacacaacgaaacacgcatgc 17117243  T
Q  202 tcaggtgtggattcggttgttggaattacctcaggaatattggatggaaa 251  Q
    |||||||||||||| ||||| |||||||||| ||||||||||||||||||    
T  17117242 tcaggtgtggattcagttgtgggaattaccttaggaatattggatggaaa 17117193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 146 - 249
Target Start/End: Complemental strand, 7812216 - 7812113
Alignment:
Q  146 cggctttttgagtcgacaaaatatttcaatgcacatacacaacgaaacacgcatgctcaggtgtggattcggttgttggaattacctcaggaatattgga 245  Q
    ||||||||||||| | | |||||||| |||   ||||| |||||||| || |||||||||||||||||| ||||| ||||||| |||| ||| |||||||    
T  7812216 cggctttttgagtgggccaaatattttaatatgcatactcaacgaaatactcatgctcaggtgtggatttggttgctggaattgcctcgggagtattgga 7812117  T
Q  246 tgga 249  Q
    ||||    
T  7812116 tgga 7812113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 249
Target Start/End: Complemental strand, 6671830 - 6671772
Alignment:
Q  191 aacacgcatgctcaggtgtggattcggttgttggaattacctcaggaatattggatgga 249  Q
    ||||| |||||||||||||||||||| ||| | ||||| |||||||| |||||||||||    
T  6671830 aacacacatgctcaggtgtggattcgattgcttgaattgcctcaggagtattggatgga 6671772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 249
Target Start/End: Complemental strand, 21910270 - 21910206
Alignment:
Q  185 caacgaaacacgcatgctcaggtgtggattcggttgttggaattacctcaggaatattggatgga 249  Q
    ||||||||||| |||||| |||| |||||| ||||| |||| ||||||||||| | |||||||||    
T  21910270 caacgaaacacccatgcttaggtatggattaggttgctggagttacctcaggagtgttggatgga 21910206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 249
Target Start/End: Original strand, 22986739 - 22986863
Alignment:
Q  125 aatttgaaacaaggtgttttacggctttttgagtcgacaaaatatttcaatgcacatacacaacgaaacacgcatgctcaggtgtggattcggttgttgg 224  Q
    ||||||||||  |||||| |||| || ||||||| | | ||| | || ||||| || |||||||||||||| |||||  | ||||||||||| ||| |||    
T  22986739 aatttgaaacctggtgttctacgactctttgagtgggctaaagactttaatgctcagacacaacgaaacacacatgccaatgtgtggattcgtttgatgg 22986838  T
Q  225 aattacctcaggaatattggatgga 249  Q
    || |||| || ||||| ||||||||    
T  22986839 aaataccacaagaatactggatgga 22986863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 249
Target Start/End: Original strand, 25801716 - 25801787
Alignment:
Q  178 acatacacaacgaaacacgcatgctcaggtgtggattcggttgttggaattacctcaggaatattggatgga 249  Q
    |||||| || || ||||| |||||||||||||||||||| ||| | ||||| |||||||| |||||||||||    
T  25801716 acatactcagcgcaacacacatgctcaggtgtggattcgattgcttgaattgcctcaggagtattggatgga 25801787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0073 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0073
Description:

Target: scaffold0073; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 249
Target Start/End: Complemental strand, 41742 - 41684
Alignment:
Q  191 aacacgcatgctcaggtgtggattcggttgttggaattacctcaggaatattggatgga 249  Q
    ||||| |||||||||||||||||||| ||| | ||||| |||||||| |||||||||||    
T  41742 aacacacatgctcaggtgtggattcgattgcttgaattgcctcaggagtattggatgga 41684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 249
Target Start/End: Complemental strand, 160262 - 160192
Alignment:
Q  179 catacacaacgaaacacgcatgctcaggtgtggattcggttgttggaattacctcaggaatattggatgga 249  Q
    ||||| ||||| ||||| |||||||||||||||||||  ||| | ||||| |||||||| |||||||||||    
T  160262 catactcaacgcaacacacatgctcaggtgtggattcaattgcttgaattgcctcaggagtattggatgga 160192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 251
Target Start/End: Original strand, 150558 - 150624
Alignment:
Q  185 caacgaaacacgcatgctcaggtgtggattcggttgttggaattacctcaggaatattggatggaaa 251  Q
    ||||| ||||| ||| |||||||||| ||| |||||||| |  ||||||||||||||| ||||||||    
T  150558 caacgcaacacccattctcaggtgtgaatttggttgttgaagctacctcaggaatatttgatggaaa 150624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 249
Target Start/End: Complemental strand, 32136482 - 32136422
Alignment:
Q  189 gaaacacgcatgctcaggtgtggattcggttgttggaattacctcaggaatattggatgga 249  Q
    ||||||| |||||||| |||||||||||  || |||||||||| || ||||| ||||||||    
T  32136482 gaaacactcatgctcaagtgtggattcgcctgatggaattaccacaagaatactggatgga 32136422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University