View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18660_low_17 (Length: 260)
Name: NF18660_low_17
Description: NF18660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18660_low_17 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 16 - 260
Target Start/End: Complemental strand, 7657320 - 7657076
Alignment:
| Q |
16 |
caccttcagatctccaaatcccttaatatgttgaagttgttgcagctgttgtaactgttgctgaagctgctgttgttgaggattttgtccttgttggcca |
115 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7657320 |
caccttcagatctccaaatcctttaatatgttgaagttgttgcagctgttgtaactgttgctgaagctgctgttgttgaggattttgtccttgttggcta |
7657221 |
T |
 |
| Q |
116 |
ccaccctttggctgattttggttatttccaggacccttttgccccttgttgttattgtttcctccaccaccttttccattgtcaatatgcatgttcttca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7657220 |
ccaccctttggctgattttggttatttccaggacccttttgccccttgttgttattgtttcctccaccaccttttccattgtcaatatgcatgttcttca |
7657121 |
T |
 |
| Q |
216 |
tttgatttggaatgttgttctggttgttattgttgttgtttgcct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7657120 |
tttgatttggaatgttgttctggttgttattgttgttgtttgcct |
7657076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 84 - 255
Target Start/End: Complemental strand, 7651875 - 7651704
Alignment:
| Q |
84 |
gctgttgttgaggattttgtccttgttggccaccaccctttggctgattttggttatttccaggacccttttgccccttgttgttattgtttcctccacc |
183 |
Q |
| |
|
|||||||||||||||| || ||||||| ||||| |||||||| || |||||||||||| |||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
7651875 |
gctgttgttgaggattctgctcttgttgtccacctccctttggttggttttggttatttataggatccttttgcccattgttgttattgttttctccacc |
7651776 |
T |
 |
| Q |
184 |
accttttccattgtcaatatgcatgttcttcatttgatttggaatgttgttctggttgttattgttgttgtt |
255 |
Q |
| |
|
|||||||||| ||||||| || ||||||||||| || |||| |||||||| |||||||||||||||||||| |
|
|
| T |
7651775 |
accttttccagtgtcaatttgaatgttcttcatctggtttgccatgttgttatggttgttattgttgttgtt |
7651704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 178 - 255
Target Start/End: Original strand, 48539207 - 48539284
Alignment:
| Q |
178 |
tccaccaccttttccattgtcaatatgcatgttcttcatttgatttggaatgttgttctggttgttattgttgttgtt |
255 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||||| | ||||| || ||||||||| || |||||||||||||| |
|
|
| T |
48539207 |
tccaccacctttgccattatcaatttgcatgttctttaactgattaacaaggttgttctgattattattgttgttgtt |
48539284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 178 - 255
Target Start/End: Original strand, 48573462 - 48573539
Alignment:
| Q |
178 |
tccaccaccttttccattgtcaatatgcatgttcttcatttgatttggaatgttgttctggttgttattgttgttgtt |
255 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||||| | ||||| || ||||||||| || |||||||||||||| |
|
|
| T |
48573462 |
tccaccacctttgccattatcaatttgcatgttctttaactgattaacaaggttgttctgattattattgttgttgtt |
48573539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University