View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18661_high_20 (Length: 239)
Name: NF18661_high_20
Description: NF18661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18661_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 21 - 136
Target Start/End: Complemental strand, 10684143 - 10684028
Alignment:
| Q |
21 |
ataaagatactatttttattaatatatttttcttgagaactgagtctttgcacttttatgaatgtttctgggggttttcaattgaccactgatcttatat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10684143 |
ataaagatactatttttattaatatatttttcttgagaactgagtctttgcacttttatgaatgtttctgggggttttcaattgaccactgatcttatat |
10684044 |
T |
 |
| Q |
121 |
tttgtggggtctcatg |
136 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10684043 |
tttgtggggtctcatg |
10684028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University